![]() #meta.fasta is my input file, meta.fastq is the output file and we are assigning quality score of 34 to all the basepairs. reformat.sh in= meta.fasta out=meta.fastq qfake=35 You can find details about bbmap and reformat.sh script elsewhere. I used reformat.sh script which is a part of bbmap. There are many tools available to convert fasta file to fastq format. This fasta file needs to be changed into fastq format. TGCCGTACCGAGTCACGAGTACCTGCAGGCAAGATGGAGGGCCTTGTTCGACTGACCTGGATAGCCCAACGCGCTTCGGTGCTGCCGGCGATTCTGGGAGAACTCAGTCGGAĪGTTGTTGATCTGTGTGAATCAGACTGCGACAGTTCGAGTTTGAAGCGAAAGCTAGCAACAGTATCAACAĪAAGCTAGCAACAGTATCAACAGGTTTTATTTTGGATTTGGAAACGAGAGTTTCTGGTCATGAAAAACCCA GTGTGGTCTGCGAGTTCTAGCCTACTCGTTTCTCCCCTACTCACTCATTCACACACAAAAAĬTACAAGATTTGGCCCTCGCACGGGATGTGCGATAACCGCAAGATTGACTCAAGCGCGGAAAGCGCTGTAACC GTTTCTCCCCTACTCACTCATTCACACACAAAAACTGTGTTGTAACTACAAGATTTGGCCCTCGCACGGGĪTGTGCGATAACCGCAAGATTGACTCAAGCGCGGAAAGCGCTGTAACCACATGCTGTTAGTCCCTTTATGĬGGGGGGTAAACCGGCTGTGTTTGCTAGAGGCACAGAGGAGCAACATCCAACCTGCTTTTGTĬGGCTCCAATTCCTGCGTCGCCAAAGGTGTTAGCGCACCCAA So, Zika virus reads should not be counted by Rsubread while aligning.ĪAGGAAGGACTGGGCATGAGGGCCCAGTCCTTCCTTTCCCCTTCCGGGGGGTAAACCGGCTGTGTTTGCTĪGAGGCACAGAGGAGCAACATCCAACCTGCTTTTGTGGGGAACGGTGCGGCTCCAATTCCTGCGTCGCCAĪAGGTGTTAGCGCACCCAAACGGCGCATCTACCAATGCTATTGGTGTGGTCTGCGAGTTCTAGCCTACTC I will be aligning my reads to Senecavirus A genome. And I also pulled some sequences from the Zika virus which are names as Zika1 and Zika2. I created a fasta file with a few contigs each containing about 70-100 basepairs, and named each contig as read 1, read 2 and so on. fasta file by pulling some of the sequences from the Senecavirus A genome. source("")įor this simulation I created a small. Another important aspect of learning RNA-Seq analysis is understanding the algorithms behind the analysis.To this end, I decided to run a small simulation to understand how RNA-Seq analysis algorithms work.It is amazing how a single R package can do things like read aligning, read mapping and read counts in few lines of codes. Softwares with graphical user interface like CLC Workbench, have made RNA-Seq data analysis quite easier.However, they are expensive and in most of the cases you might not be able to tweak your analysis in the exact way you want. First-time users of CLC Gx on our workstation computers must complete the Workstation Request Form.RNA-Seq data analysis can be complicated.All USC users can freely access the software on our workstation computers.Equipped with dual-CPU and 512GB RAM, one of our workstation computers is configured specifically to handle large data set and computationally intensive tasks such as de novo genome assembly and sequencing alignment.Wilson Dental Library, the University Park Campus.Norris Medical Library (RM203A), the Health Sciences Campus.The software has been installed on multiple workstation computers:.On workstation computers in the libraries.Mandatory registration is required for installing CLC Gx on your computer. Please submit the Local Installation Request Form.The computer must be connected to the USC network, either via Ethernet cable on campus or via USC VPN when using wireless (applies to both on- and off-campus wireless connections).Minimum hardware requirement for de novo assembly, metagenomics, and raw reads alignment:: 32GB RAM and Intel i7-6700 or faster processor.Minimum hardware requirement for general use: 16GB RAM and Intel i7-2600 or faster processor.The license consists of TWO concurrent user seats. USC has licensed CLC Gx for the free use of USC faculty, students and staff. ![]()
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |